PP_072_pAAV_hSyn_DIO-LR-Voltron2-P2A-LR-CheRiff-HA
(Plasmid
#230988)
-
PurposeCo-expressing membrane-localized Voltron2 and membrane-localized CheRiff.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 230988 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4462
- Total vector size (bp) 7522
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCre-dependent, membrane-localized optopatch for neuronal dendrites
-
SpeciesSynthetic
-
Insert Size (bp)3060
- Promoter hSyn
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcgcagtcgagaaggtaccggatc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PP_072_pAAV_hSyn_DIO-LR-Voltron2-P2A-LR-CheRiff-HA was a gift from Adam Cohen (Addgene plasmid # 230988 ; http://n2t.net/addgene:230988 ; RRID:Addgene_230988) -
For your References section:
Voltage dynamics of dendritic integration and back-propagation in vivo. Wong-Campos JD, Park P, Davis H, Qi Y, Tian H, Itkis DG, Kim D, Grimm JB, Plutkis SE, Lavis L, Cohen AE. bioRxiv [Preprint]. 2023 May 26:2023.05.25.542363. doi: 10.1101/2023.05.25.542363. 10.1101/2023.05.25.542363 PubMed 37292691