pFastBac Dual His6-TEV-CUL2, Rbx1
(Plasmid
#231000)
-
PurposeDual expression vector containing mouse CUL2 and Rbx1 for protein puritification from SF9 insect cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 231000 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFastbac Duel
-
Vector typeInsect Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameRbx1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)327
-
Entrez GeneRbx1 (a.k.a. 1500002P15Rik, ROC1)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer TGGGACGGTATGAATAATCC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCUL2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2287
-
Entrez GeneCul2 (a.k.a. 1300003D18Rik, 4932411N15Rik, mKIAA4106)
-
Tag
/ Fusion Protein
- 6x HIS (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GGATTATTCATACCGTCCCA
- 3′ sequencing primer CAAATGTGGTATGGCTGATT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFastBac Dual His6-TEV-CUL2, Rbx1 was a gift from Michael Rape (Addgene plasmid # 231000 ; http://n2t.net/addgene:231000 ; RRID:Addgene_231000) -
For your References section:
A Cellular Mechanism to Detect and Alleviate Reductive Stress. Manford AG, Rodriguez-Perez F, Shih KY, Shi Z, Berdan CA, Choe M, Titov DV, Nomura DK, Rape M. Cell. 2020 Oct 1;183(1):46-61.e21. doi: 10.1016/j.cell.2020.08.034. Epub 2020 Sep 16. 10.1016/j.cell.2020.08.034 PubMed 32941802