Skip to main content

pFastBac Dual His6-TEV-CUL2, Rbx1
(Plasmid #231000)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 231000 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFastbac Duel
  • Vector type
    Insect Expression
  • Selectable markers
    Gentamicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Rbx1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    327
  • Entrez Gene
    Rbx1 (a.k.a. 1500002P15Rik, ROC1)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer TGGGACGGTATGAATAATCC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    CUL2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2287
  • Entrez Gene
    Cul2 (a.k.a. 1300003D18Rik, 4932411N15Rik, mKIAA4106)
  • Tag / Fusion Protein
    • 6x HIS (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GGATTATTCATACCGTCCCA
  • 3′ sequencing primer CAAATGTGGTATGGCTGATT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFastBac Dual His6-TEV-CUL2, Rbx1 was a gift from Michael Rape (Addgene plasmid # 231000 ; http://n2t.net/addgene:231000 ; RRID:Addgene_231000)
  • For your References section:

    A Cellular Mechanism to Detect and Alleviate Reductive Stress. Manford AG, Rodriguez-Perez F, Shih KY, Shi Z, Berdan CA, Choe M, Titov DV, Nomura DK, Rape M. Cell. 2020 Oct 1;183(1):46-61.e21. doi: 10.1016/j.cell.2020.08.034. Epub 2020 Sep 16. 10.1016/j.cell.2020.08.034 PubMed 32941802