pSico-syn-GFP-TVA-oG-WPRE-bGHpA
(Plasmid
#231009)
-
PurposeLentiviral helper virus for G-deleted rabies tracing
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 231009 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSico
-
Backbone manufacturerTyler Jacks
- Backbone size w/o insert (bp) 5005
- Total vector size (bp) 9360
-
Modifications to backboneCMV promoter was swapped for synapsin promoter. The transgene is flipped relative to LTRs, and requires co-transfection with Nodamura B2 (Addgene #17228) during viral packaging to obtain high titers.
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameEnhanced GFP
-
Alt nameEGFP
-
SpeciesSynthetic
-
Insert Size (bp)717
- Promoter human synapsin I
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer agtcgtgtcgtgcctgagag
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameTVA
-
SpeciesG. gallus (chicken)
-
Insert Size (bp)471
-
Entrez GeneCD320 (a.k.a. TVA)
- Promoter human synapsin I
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGGACGAGCTGTACAAGG
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameoptimized G
-
Alt nameoG
-
SpeciesSynthetic
-
Insert Size (bp)1575
- Promoter human synapsin I
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer AGGCGGACCTGTTCAGTG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byEuiseok Kim and Ed Callaway (optimized G).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.10.01.616167 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSico-syn-GFP-TVA-oG-WPRE-bGHpA was a gift from Tomasz Nowakowski (Addgene plasmid # 231009 ; http://n2t.net/addgene:231009 ; RRID:Addgene_231009) -
For your References section:
High-Complexity Barcoded Rabies Virus for Scalable Circuit Mapping Using Single-Cell and Single-Nucleus Sequencing. Shin D, Urbanek ME, Larson HH, Moussa AJ, Lee KY, Baker DL, Standen-Bloom E, Ramachandran S, Bogdanoff D, Cadwell CR, Nowakowski TJ. bioRxiv [Preprint]. 2024 Dec 11:2024.10.01.616167. doi: 10.1101/2024.10.01.616167. 10.1101/2024.10.01.616167 PubMed 39713304