Skip to main content

pSico-U6-tornado:6xMBS:8G8ApA-syn-GFP-TVA-oG-WPRE-bGHpA
(Plasmid #231013)

Ordering

This material is available to academics and nonprofits only. Orders shipped outside the U.S. may require additional regulatory approval, as well as a non-refundable export license fee of $85. Please log in to view availability.
Item Catalog # Description Quantity Price (USD)
Plasmid 231013 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSico
  • Backbone manufacturer
    Tyler Jacks
  • Backbone size w/o insert (bp) 5005
  • Total vector size (bp) 9360
  • Modifications to backbone
    CMV promoter was swapped for synapsin promoter. The transgene is flipped relative to LTRs, and requires co-transfection with Nodamura B2 (Addgene #17228) during viral packaging to obtain high titers.
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Enhanced GFP
  • Alt name
    EGFP
  • Species
    Synthetic
  • Insert Size (bp)
    717
  • Promoter human synapsin I

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    TVA
  • Species
    G. gallus (chicken)
  • Insert Size (bp)
    471
  • Entrez Gene
    CD320 (a.k.a. TVA)
  • Promoter human synapsin I

Cloning Information for Gene/Insert 2

Gene/Insert 3

  • Gene/Insert name
    optimized G
  • Alt name
    oG
  • Species
    Synthetic
  • Insert Size (bp)
    1575
  • Promoter human synapsin I

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTCGTCCCGGATAAGAGTC
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    Tornado expression system containing 6X MS2 binding sites and 8G8A synthetic poly A capture sequence
  • Species
    Synthetic
  • Insert Size (bp)
    659
  • Promoter human U6

Cloning Information for Gene/Insert 4

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Euiseok Kim and Ed Callaway (optimized G), Samie Jaffrey (tornado expression system), Robert Singer (high affinity 6x MS2 sequence).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.10.01.616167 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSico-U6-tornado:6xMBS:8G8ApA-syn-GFP-TVA-oG-WPRE-bGHpA was a gift from Tomasz Nowakowski (Addgene plasmid # 231013 ; http://n2t.net/addgene:231013 ; RRID:Addgene_231013)
  • For your References section:

    High-Complexity Barcoded Rabies Virus for Scalable Circuit Mapping Using Single-Cell and Single-Nucleus Sequencing. Shin D, Urbanek ME, Larson HH, Moussa AJ, Lee KY, Baker DL, Standen-Bloom E, Ramachandran S, Bogdanoff D, Cadwell CR, Nowakowski TJ. bioRxiv [Preprint]. 2024 Dec 11:2024.10.01.616167. doi: 10.1101/2024.10.01.616167. 10.1101/2024.10.01.616167 PubMed 39713304