pLV-hU6-FOXP2_sgRNA1-hUbC-dCas9-KRAB-T2a-GFP
(Plasmid
#231022)
-
PurposeAll-in-one lentiviral vector (Gersbach lab design) for CRISPRi targeting FOXP2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 231022 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAddgene #71237
-
Backbone manufacturerCharles Gersbach
- Backbone size w/o insert (bp) 14962
- Total vector size (bp) 14982
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFOXP2 sgRNA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
- Promoter U6
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer GACTATCATATGCTTACCGT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-hU6-FOXP2_sgRNA1-hUbC-dCas9-KRAB-T2a-GFP was a gift from Tomasz Nowakowski (Addgene plasmid # 231022 ; http://n2t.net/addgene:231022 ; RRID:Addgene_231022) -
For your References section:
Thalamocortical organoids enable in vitro modeling of 22q11.2 microdeletion associated with neuropsychiatric disorders. Shin D, Kim CN, Ross J, Hennick KM, Wu SR, Paranjape N, Leonard R, Wang JC, Keefe MG, Pavlovic BJ, Donohue KC, Moreau C, Wigdor EM, Larson HH, Allen DE, Cadwell CR, Bhaduri A, Popova G, Bearden CE, Pollen AA, Jacquemont S, Sanders SJ, Haussler D, Wiita AP, Frost NA, Sohal VS, Nowakowski TJ. Cell Stem Cell. 2024 Mar 7;31(3):421-432.e8. doi: 10.1016/j.stem.2024.01.010. Epub 2024 Feb 20. 10.1016/j.stem.2024.01.010 PubMed 38382530