L1p1_min35S_Luciferase
(Plasmid
#231035)
-
PurposeCloning vector to clone promoter fragment in front of minimal p35S:Luciferase:tNOS
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 231035 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepICH47732
- Backbone size w/o insert (bp) 4376
-
Vector typeBacterial Expression, Luciferase
-
Selectable markersRFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMinimal p35S:Luciferase:tNOS
-
SpeciesSynthetic
-
Insert Size (bp)2930
- Promoter minimal p35S
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer GTGGTGTAAACAAATTGACGC
- 3′ sequencing primer CCCGCCAATATATCCTGTCA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Additional insert mRFP.
Please visit https://doi.org/10.1101/2024.08.22.609225 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
L1p1_min35S_Luciferase was a gift from Wilma van Esse (Addgene plasmid # 231035 ; http://n2t.net/addgene:231035 ; RRID:Addgene_231035) -
For your References section:
VULGARE ROW-TYPE SIX 5 binds to the promoter of tillering and floral homeotic genes to regulate their expression. Winkelmolen T, Colleoni P, Moscou MJ, Hoseinzadeh P, Oldach K, Schmidt RC, Immink RGH, van Esse GW. Plant Physiol. 2025 Aug 4;198(4):kiaf309. doi: 10.1093/plphys/kiaf309. 10.1093/plphys/kiaf309 PubMed 40671593