Skip to main content

pPMS-2397
(Plasmid #231044)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 231044 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRK5
  • Vector type
    Mammalian Expression, Affinity Reagent/ Antibody

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    anti GFP DARPin fused to chicken Fc
  • Species
    G. gallus (chicken)
  • Tag / Fusion Protein
    • 8xHis (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer CACTATAGAATAACATCCACT
  • 3′ sequencing primer GCTTTATTTGTGAAATTTGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPMS-2397 was a gift from Jeremy Nathans (Addgene plasmid # 231044 ; http://n2t.net/addgene:231044 ; RRID:Addgene_231044)