pNY-346
(Plasmid
#231046)
-
PurposeUsed for staining GFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 231046 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRK5
-
Vector typeMammalian Expression, Affinity Reagent/ Antibody
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameanti GFP DARPin fused to human Fc
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer CACTATAGAATAACATCCACT
- 3′ sequencing primer GCTTTATTTGTGAAATTTGTG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNY-346 was a gift from Jeremy Nathans (Addgene plasmid # 231046 ; http://n2t.net/addgene:231046 ; RRID:Addgene_231046)