xPERT-hA2q
(Plasmid
#231063)
-
PurposeCircularly permuted CasRx platform fused to human deaminase domain for A to I editing
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 231063 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepC0053
- Backbone size w/o insert (bp) 4400
- Total vector size (bp) 9642
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namedCas13d
-
SpeciesH. sapiens (human); Ruminococcus flavefaciens XPD3002
-
Insert Size (bp)3060
-
MutationK490L
- Promoter CMV
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameHuman deaminase ADAR2dd
-
SpeciesRuminococcus flavefaciens XPD3002
-
Insert Size (bp)1154
-
MutationH460D, E488Q, only the deaminase domain (aa 276-702 are expressed)
-
Entrez GeneADARB1 (a.k.a. ADAR2, DRABA2, DRADA2, NEDHYMS, RED1)
- Promoter CMV
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer cagctgcatttaccgcaggt
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
xPERT-hA2q was a gift from Meng How Tan (Addgene plasmid # 231063 ; http://n2t.net/addgene:231063 ; RRID:Addgene_231063) -
For your References section:
A circularly permuted CasRx platform for efficient, site-specific RNA editing. Wang Y, Liu KI, Liu MM, Ooi KH, Nguyen TA, Chee JE, Teo SXD, He S, Tay JWD, Teo SY, Liew KS, Ge XY, Ng ZJ, Avagyan H, Liu H, Yi Z, Chang K, Kok EPL, Chen R, Yau CE, Koh JW, Wan Y, Tan MH. Nat Biotechnol. 2024 Oct 9. doi: 10.1038/s41587-024-02430-w. 10.1038/s41587-024-02430-w PubMed 39385008