Skip to main content

pTE5444
(Plasmid #231064)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 231064 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pME_G_E_0008_pET16b_entry vector_sfGFP
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PT7-lacO-g10lead-10xHisTag-phi29 DNAP_PovSak
  • Promoter PT7-lacO
  • Tag / Fusion Protein
    • 10x His-tag + Factor Xa recognition site (N terminal on backbone)

Cloning Information

  • Cloning method Golden Gate
  • 5′ sequencing primer ATGCGTCCGGCGTAG
  • 3′ sequencing primer GAAGCCTGCATAACGCGAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2025.07.08.663768 bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTE5444 was a gift from Tobias Erb (Addgene plasmid # 231064 ; http://n2t.net/addgene:231064 ; RRID:Addgene_231064)
  • For your References section:

    Genetically encoded control of in vitro transcription-translation coupled DNA replication. Barthel S, Hoffmann-Becking M, Karimov IG, Erb TJ. bioRxiv 2025.07.08.663768; doi: 10.1101/2025.07.08.663768 10.1101/2025.07.08.663768