pet29(b+) AIcrVIA2
(Plasmid
#231126)
-
PurposePlasmid for bacterial expression and purification of AIcrVIA2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 231126 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET29b (+)
-
Backbone manufacturerTwistDNA
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAicrVIA2
-
SpeciesSynthetic
- Promoter T7
-
Tag
/ Fusion Protein
- 6XHis (C terminal on insert)
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.12.05.626932 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pet29(b+) AIcrVIA2 was a gift from Gavin Knott (Addgene plasmid # 231126 ; http://n2t.net/addgene:231126 ; RRID:Addgene_231126) -
For your References section:
De novo design of potent CRISPR-Cas13 inhibitors. Taveneau C, Chai HX, D'Silva J, Bamert RS, Chen H, Hayes BK, Calvert RW, Purcell J, Curwen DJ, Munder F, Martin LL, Barr JJ, Rosenbluh J, Fareh M, Grinter R, Knott GJ. Nat Chem Biol. 2026 Jan 26. doi: 10.1038/s41589-025-02136-3. 10.1038/s41589-025-02136-3 PubMed 41588195