VirTREX2-HLDel-1_NbATML1-1pro
(Plasmid
#231149)
-
PurposeT-DNA encoding TRV2 with TREX2 and mobile gRNA targeting NbATML1-1pro
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 231149 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEE083
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTREX2 and mobile gRNA targeting NbATML1-1pro
-
gRNA/shRNA sequenceGATGCAATAGCATTTAATCG
-
SpeciesM. musculus (mouse); Nicotiana benthamania
- Promoter PEBV sub-genomic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
also contains mobile sequences from tRNAIleu
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VirTREX2-HLDel-1_NbATML1-1pro was a gift from Daniel Voytas (Addgene plasmid # 231149 ; http://n2t.net/addgene:231149 ; RRID:Addgene_231149) -
For your References section:
Heritable, multinucleotide deletions in plants using viral delivery of a repair exonuclease and guide RNAs. Liu D, Myers EA, Xuan S, Prichard LE, Donahue LI, Ellison EE, Starker CG, Voytas DF. Plant Physiol. 2024 Mar 29;194(4):2229-2239. doi: 10.1093/plphys/kiae015. 10.1093/plphys/kiae015 PubMed 38243587