Skip to main content

VirTREX2-HLDel-1_NbmiR164e/h
(Plasmid #231156)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 231156 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEE083
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TREX2 and mobile gRNA targeting NbmiR164e/h
  • gRNA/shRNA sequence
    TAGCTCTCGTTGGAGAAGCA
  • Species
    M. musculus (mouse); Nicotiana benthamania
  • Promoter PEBV sub-genomic

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

also contains mobile sequences from tRNAIleu

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    VirTREX2-HLDel-1_NbmiR164e/h was a gift from Daniel Voytas (Addgene plasmid # 231156 ; http://n2t.net/addgene:231156 ; RRID:Addgene_231156)
  • For your References section:

    Heritable, multinucleotide deletions in plants using viral delivery of a repair exonuclease and guide RNAs. Liu D, Myers EA, Xuan S, Prichard LE, Donahue LI, Ellison EE, Starker CG, Voytas DF. Plant Physiol. 2024 Mar 29;194(4):2229-2239. doi: 10.1093/plphys/kiae015. 10.1093/plphys/kiae015 PubMed 38243587