pDL518
(Plasmid
#231160)
-
PurposeT-DNA encoding TRV2 with mobile gRNA targeting SlPDS
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 231160 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEE083
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemobile gRNA targeting SlPDS
-
gRNA/shRNA sequenceGGACTCTTGCCAGCAATGCT
-
SpeciesSolanum lycopersicum
- Promoter PEBV sub-genomic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
also contains mobile sequences from tRNAIleu
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDL518 was a gift from Daniel Voytas (Addgene plasmid # 231160 ; http://n2t.net/addgene:231160 ; RRID:Addgene_231160) -
For your References section:
Heritable gene editing in tomato through viral delivery of isopentenyl transferase and single-guide RNAs to latent axillary meristematic cells. Liu D, Ellison EE, Myers EA, Donahue LI, Xuan S, Swanson R, Qi S, Prichard LE, Starker CG, Voytas DF. Proc Natl Acad Sci U S A. 2024 Sep 24;121(39):e2406486121. doi: 10.1073/pnas.2406486121. Epub 2024 Sep 16. 10.1073/pnas.2406486121 PubMed 39284063