Skip to main content
Addgene

pDL691
(Plasmid #231166)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 231166 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEE844
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ipt and mobile gRNAs targeting SlUGT75C1 and SlHAIRLESS
  • gRNA/shRNA sequence
    CCTATCGTCAGGTGTACCTG, AGGGTGCATGAGGCTTGCCA
  • Species
    Solanum lycopersicum, Agrobacterium tumefaciens
  • Promoter PEBV sub-genomic

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

also contains mobile sequences from tRNAIleu

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDL691 was a gift from Daniel Voytas (Addgene plasmid # 231166 ; http://n2t.net/addgene:231166 ; RRID:Addgene_231166)
  • For your References section:

    Heritable gene editing in tomato through viral delivery of isopentenyl transferase and single-guide RNAs to latent axillary meristematic cells. Liu D, Ellison EE, Myers EA, Donahue LI, Xuan S, Swanson R, Qi S, Prichard LE, Starker CG, Voytas DF. Proc Natl Acad Sci U S A. 2024 Sep 24;121(39):e2406486121. doi: 10.1073/pnas.2406486121. Epub 2024 Sep 16. 10.1073/pnas.2406486121 PubMed 39284063
Commonly requested with: