pcDNA5/FRT/TO-Flag-Tipin-L195A
(Plasmid
#23118)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 23118 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA5/FRT/TO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5137
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTipin
-
Alt nameTimeless-interacting protein
-
SpeciesH. sapiens (human)
-
Insert Size (bp)903
-
MutationChanged Leucine 195 to Alanine
-
Entrez GeneTIPIN
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CMV: CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer BGH (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA5/FRT/TO-Flag-Tipin-L195A was a gift from Aziz Sancar (Addgene plasmid # 23118 ; http://n2t.net/addgene:23118 ; RRID:Addgene_23118) -
For your References section:
Tipin-replication protein A interaction mediates Chk1 phosphorylation by ATR in response to genotoxic stress. Kemp MG, Akan Z, Yilmaz S, Grillo M, Smith-Roe SL, Kang TH, Cordeiro-Stone M, Kaufmann WK, Abraham RT, Sancar A, Unsal-Kacmaz K. J Biol Chem. 2010 May 28;285(22):16562-71. doi: 10.1074/jbc.M110.110304. Epub 2010 Mar 15. 10.1074/jbc.M110.110304 PubMed 20233725