Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA5/FRT/TO-Flag-Tipin-L195A
(Plasmid #23118)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 23118 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA5/FRT/TO
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5137
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Tipin
  • Alt name
    Timeless-interacting protein
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    903
  • Mutation
    Changed Leucine 195 to Alanine
  • Entrez Gene
    TIPIN
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CMV: CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer BGH
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA5/FRT/TO-Flag-Tipin-L195A was a gift from Aziz Sancar (Addgene plasmid # 23118 ; http://n2t.net/addgene:23118 ; RRID:Addgene_23118)
  • For your References section:

    Tipin-RPA interaction mediates Chk1 phosphorylation by ATR in response to genotoxic stress. Kemp MG, Akan Z, Yilmaz S, Grillo M, Smith-Roe SL, Kang TH, Cordeiro-Stone M, Kaufmann WK, Abraham RT, Sancar A, Unsal-Kacmaz K. J Biol Chem. 2010 Mar 15. ():. 10.1074/jbc.M110.110304 PubMed 20233725