pHR'CMVGFP_hRIF1(1924-2446)IREShygro
              
              
                (Plasmid
                
                #23138)
              
            
            
            
          - 
              Depositing Lab
- 
          Publication
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 23138 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepHR'CMVGFPIREShygro_WSIN18
- 
              Backbone manufacturerDidier Trono Lab
- Backbone size w/o insert (bp) 10000
- 
              Vector typeMammalian Expression, Lentiviral
- 
                Selectable markersHygromycin
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature30°C
- 
            Growth Strain(s)Stbl3
- 
              Growth instructionsGrow in DH5a @ 30C
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameRIF1 deletion construct
- 
                  Alt nameGFP_hRIF1(406-2446)
- 
                    SpeciesH. sapiens (human)
- 
                  Insert Size (bp)2424
- 
                        Entrez GeneRIF1
- 
    
        Tag
        / Fusion Protein
    - GFP (N terminal on insert)
 
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CAGAGCTCGTTTAGTGAACCGTCAG (Common Sequencing Primers)
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Backbone vector sequence is only approximated. Please contact the Trono lab for full vector sequence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pHR'CMVGFP_hRIF1(1924-2446)IREShygro was a gift from Lifeng Xu (Addgene plasmid # 23138 ; http://n2t.net/addgene:23138 ; RRID:Addgene_23138)
- 
                For your References section: Human Rif1 protein binds aberrant telomeres and aligns along anaphase midzone microtubules. Xu L, Blackburn EH. J Cell Biol. 2004 Dec 6. 167(5):819-30. 10.1083/jcb.200408181 PubMed 15583028
