Skip to main content

pAAV-u6-gRNA(deltaD1)-hSyn-mCherry
(Plasmid #231400)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 231400 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA(DRD1.2)
  • gRNA/shRNA sequence
    ctgggcaatcctgtagatac
  • Species
    rodents
  • Insert Size (bp)
    20
  • Promoter u6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Lgu1 (destroyed during cloning)
  • 3′ cloning site Lgu1 (destroyed during cloning)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Inserted gRNA targeting DRD1 ctgggcaatcctgtagatac into Plasmid #87916.

Please visit https://doi.org/10.1101/2025.10.21.683401 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-u6-gRNA(deltaD1)-hSyn-mCherry was a gift from Arjen Boender & Larry Young (Addgene plasmid # 231400 ; http://n2t.net/addgene:231400 ; RRID:Addgene_231400)
  • For your References section:

    Comparative gene editing reduces dopamine receptor levels across rodent species. Karkare SC, Aspesi D, Garner KM, Schut EHS, Albers HE, Meye FJ, Murugan M, Boender AJ. bioRxiv 2025.10.21.683401 10.1101/2025.10.21.683401