pAAV-u6-gRNA(deltaD1)-hSyn-mCherry
(Plasmid
#231400)
-
PurposeKnockdown of DRD1 across rodent species
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 231400 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA(DRD1.2)
-
gRNA/shRNA sequencectgggcaatcctgtagatac
-
Speciesrodents
-
Insert Size (bp)20
- Promoter u6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Lgu1 (destroyed during cloning)
- 3′ cloning site Lgu1 (destroyed during cloning)
- 5′ sequencing primer GAGGGCCTATTTCCCATGATTC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Inserted gRNA targeting DRD1 ctgggcaatcctgtagatac into Plasmid #87916.
Please visit https://doi.org/10.1101/2025.10.21.683401 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-u6-gRNA(deltaD1)-hSyn-mCherry was a gift from Arjen Boender & Larry Young (Addgene plasmid # 231400 ; http://n2t.net/addgene:231400 ; RRID:Addgene_231400) -
For your References section:
Comparative gene editing reduces dopamine receptor levels across rodent species. Karkare SC, Aspesi D, Garner KM, Schut EHS, Albers HE, Meye FJ, Murugan M, Boender AJ. bioRxiv [Preprint]. 2025 Oct 21:2025.10.21.683401. doi: 10.1101/2025.10.21.683401. 10.1101/2025.10.21.683401 PubMed 41278950