pAAV-GFAP-spCas9
(Plasmid
#231403)
-
PurposeExpresses spCas9 from GFAP promoter
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 231403 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGFAP promoter
-
SpeciesM. musculus (mouse)
-
Entrez GeneGfap
- Promoter GFAP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xba1 (unknown if destroyed)
- 3′ cloning site Age1 (not destroyed)
- 5′ sequencing primer ggcctctagatctgcaagca
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Replaced RSV promoter from Plasmid #87916 Lei lab with GFAP promoter
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-GFAP-spCas9 was a gift from Arjen Boender & Larry Young (Addgene plasmid # 231403 ; http://n2t.net/addgene:231403 ; RRID:Addgene_231403)