Skip to main content

pAAV-hSyn-spCas9
(Plasmid #231404)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 231404 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    hSYN promoter
  • Species
    H. sapiens (human)
  • Mutation
    Changed RSV promoter to hSYN promoter
  • Entrez Gene
    RIC8B (a.k.a. RIC8, hSyn)
  • Promoter hSYN

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xba1 (not destroyed)
  • 3′ cloning site Age (not destroyed)
  • 5′ sequencing primer cctctagaagtgcaagtggg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Replaced RSV promoter in Plasmid #85450 from Lei lab with hSyn promoter.

Please visit https://doi.org/10.1101/2024.07.15.603543 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-spCas9 was a gift from Arjen Boender & Larry Young (Addgene plasmid # 231404 ; http://n2t.net/addgene:231404 ; RRID:Addgene_231404)
  • For your References section:

    Oxytocin facilitates social behavior of female rats via selective modulation of interneurons in the medial prefrontal cortex. Schimmer S, Kania A, Lefevre A, Afordakos K, Wang K-Y, Lebedeva J, Rozov A, Raftogianni A, Tiwari R, Netser S, Zovko A, Shaheen H, Schimmer J, Patwell R, Denis C, Grelot V, Petitjean J, Geng L, Hefter D, Boender A, Podpecan Y, Schommer F, Schubert T, Sanetra A, Trenk A, Gugula A, Hurlemann R, Wagner S, Li Y, Althammer F, Blasiak A, Melzer S, Monyer H, Charlet A, Eliava M, Grinevich V. bioRxiv 2024.07.15.603543; doi: https://doi.org/10.1101/2024.07.15.603543 10.1101/2024.07.15.603543