pLANT-2b
(Plasmid
#231487)
-
PurposeExpresses His6-SUMO^NIT-FraB where "NIT" stands for "no internal translation", reflecting the mutation of the two Shine-Dalgarno-like sequences within the SUMO tag.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 231487 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLANT-2b
- Backbone size w/o insert (bp) 4665
- Total vector size (bp) 5937
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameSUMO^NIT
-
Alt nameSmall ubiquitin-like modifier
-
Alt nameSmt3
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)294
-
MutationM83L, E84Q, D85N, G97A, G98G (synonymous mutation)
-
Entrez GeneSMT3 (a.k.a. YDR510W)
- Promoter T7 promoter
-
Tag
/ Fusion Protein
- His6 tag (N terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer taatacgactcactataggggaattgtg
- 3′ sequencing primer gctagttattgctcagcgg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameFraB
-
Alt name6-phosphofructose aspartate deglycase
-
SpeciesSalmonella enterica subsp. enterica serovar Typhimurium
-
Insert Size (bp)978
-
MutationDeleted amino acids 1-6 (MEPEES).
-
GenBank IDCP026700.1
- Promoter T7 promoter
-
Tag
/ Fusion Protein
- His6-SUMO^NIT
Cloning Information for Gene/Insert 2
- Cloning method Other
- 5′ sequencing primer taatacgactcactataggggaattgtg
- 3′ sequencing primer gctagttattgctcagcgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLANT-2b was a gift from Venkat Gopalan (Addgene plasmid # 231487 ; http://n2t.net/addgene:231487 ; RRID:Addgene_231487)