pUb-tdTomato-LP-Neo-LP
(Plasmid
#231509)
-
PurposeFluorescent reporter for tdTomato expression in Acanthamoeba via the Cre/loxP system
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 231509 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLPBLP
- Backbone size w/o insert (bp) 3433
- Total vector size (bp) 6607
-
Vector typeUnspecified ; Acanthamoeba castellanii Neff strain
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nametdTomato fluorescent protein
-
Alt nametdTomato
-
SpeciesDiscosoma sp.
-
Insert Size (bp)1431
- Promoter Acanthamoeba polyubiquitin
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCTGACCGCAGCGTAGAACAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUb-tdTomato-LP-Neo-LP was a gift from Yeonchul Hong (Addgene plasmid # 231509 ; http://n2t.net/addgene:231509 ; RRID:Addgene_231509)