pGAPDH-Cre-HYG
(Plasmid
#231510)
-
PurposeExpresses Cre recombinase in Acanthamoeba
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 231510 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGAPDH-EGFP-NEO
- Backbone size w/o insert (bp) 6092
- Total vector size (bp) 7145
-
Vector typeUnspecified ; Acanthamoeba castellanii Neff strain
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCre recombinase
-
Alt nameCre
-
SpeciesEscherichia phage P1
-
Insert Size (bp)1032
-
GenBank IDOP279344
- Promoter Acanthamoeba GAPDH
-
Tags
/ Fusion Proteins
- SV40 NLS (N terminal on insert)
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACACAGCAGCAAACACCACTCTCTCAC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGAPDH-Cre-HYG was a gift from Yeonchul Hong (Addgene plasmid # 231510 ; http://n2t.net/addgene:231510 ; RRID:Addgene_231510) -
For your References section:
Establishing a Cre/loxP-based genetic manipulation system for Acanthamoeba: Targeted genome editing and stable reporter expression. Aung JM, Joo SY, Na BK, Bang S, Shin M, Goo YK, Hong Y. Parasites Hosts Dis. 2025 Feb;63(1):25-36. doi: 10.3347/PHD.24078. Epub 2025 Feb 25. 10.3347/PHD.24078 PubMed 40045678