Skip to main content

pMVP-SEC24C
(Plasmid #231559)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 231559 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMVP
  • Backbone size w/o insert (bp) 7594
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SEC24C
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3285
  • Mutation
    silent PAM mutations (G67 (GGG>GGA) and A115 (GCC>GCA))
  • Entrez Gene
    SEC24C
  • Promoter CMV
  • Tag / Fusion Protein
    • V5 (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CMV Promoter (Forward)
  • 3′ sequencing primer BGH (Reverse)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

SEC24C cDNA synthesized by TWIST Bioscience; closed, PAM mutation (silent mutations of G67 (GGG>GGA) and A115 (GCC>GCA)) and therefore resistant to sgSEC24C #1 (AAGAGCCCCACCTTCCTCGG) and #2 (CTGTGGGCAACCAGCCACCT))

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMVP-SEC24C was a gift from Rizwan Haq (Addgene plasmid # 231559 ; http://n2t.net/addgene:231559 ; RRID:Addgene_231559)
  • For your References section:

    Genomic mediators of acquired resistance to immunotherapy in metastatic melanoma. Schiantarelli J, Benamar M, Park J, Sax HE, Oliveira G, Bosma-Moody A, Campbell KM, Liu D, Johnson DB, Rodig S, Wu CJ, Hodi FS, Ribas A, Van Allen E, Haq R. Cancer Cell. 2025 Feb 10;43(2):308-316.e6. doi: 10.1016/j.ccell.2025.01.009. 10.1016/j.ccell.2025.01.009 PubMed 39933900