pMVP-SEC24C-S107F
(Plasmid
#231561)
-
PurposepMVP expression vector for human SEC24C (S107F mutation, closesd, resistant to sgSEC24C #1 and #2) (Blasticidin selection marker)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 231561 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMVP
- Backbone size w/o insert (bp) 7594
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSEC24C (S107F)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3285
-
MutationS107F, silent PAM mutations (G67 (GGG>GGA) and A115 (GCC>GCA))
-
Entrez GeneSEC24C
- Promoter CMV
-
Tag
/ Fusion Protein
- V5 (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CMV Promoter (Forward)
- 3′ sequencing primer BGH (Reverse)
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
SEC24C cDNA synthesized by TWIST Bioscience; closed, PAM mutation (silent mutations of G67 (GGG>GGA) and A115 (GCC>GCA)) and therefore resistant to sgSEC24C #1 (AAGAGCCCCACCTTCCTCGG) and #2 (CTGTGGGCAACCAGCCACCT))
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMVP-SEC24C-S107F was a gift from Rizwan Haq (Addgene plasmid # 231561 ; http://n2t.net/addgene:231561 ; RRID:Addgene_231561) -
For your References section:
Genomic mediators of acquired resistance to immunotherapy in metastatic melanoma. Schiantarelli J, Benamar M, Park J, Sax HE, Oliveira G, Bosma-Moody A, Campbell KM, Liu D, Johnson DB, Rodig S, Wu CJ, Hodi FS, Ribas A, Van Allen E, Haq R. Cancer Cell. 2025 Feb 10;43(2):308-316.e6. doi: 10.1016/j.ccell.2025.01.009. 10.1016/j.ccell.2025.01.009 PubMed 39933900