Skip to main content
Addgene

pLentiCRISPRpuro-sgSEC24C #2
(Plasmid #231564)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 231564 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLentiCRISPR-Puro
  • Backbone size w/o insert (bp) 13000
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgSEC24C #2
  • gRNA/shRNA sequence
    CTGTGGGCAACCAGCCACCT
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20
  • Entrez Gene
    SEC24C
  • Promoter U6, EF-1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer LKO.1 (Forward)
  • 3′ sequencing primer WPRE (Reverse)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCRISPRpuro-sgSEC24C #2 was a gift from Rizwan Haq (Addgene plasmid # 231564 ; http://n2t.net/addgene:231564 ; RRID:Addgene_231564)
  • For your References section:

    Genomic mediators of acquired resistance to immunotherapy in metastatic melanoma. Schiantarelli J, Benamar M, Park J, Sax HE, Oliveira G, Bosma-Moody A, Campbell KM, Liu D, Johnson DB, Rodig S, Wu CJ, Hodi FS, Ribas A, Van Allen E, Haq R. Cancer Cell. 2025 Feb 10;43(2):308-316.e6. doi: 10.1016/j.ccell.2025.01.009. 10.1016/j.ccell.2025.01.009 PubMed 39933900