pInducer20 ALPK1 V1092A
(Plasmid
#231588)
-
PurposeALPK1 gene mutated in position V1092A (mutation found in spiradenomacarcinoma (sweat gland cancer)) under control of a doxycycline-inducible promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 231588 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepINDUCER20
-
Backbone manufacturerAddgene 44012
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameALPK1
-
Alt namealpha kinase 1
-
SpeciesH. sapiens (human)
-
Mutationchanged Valine1092 to Alanine
-
Entrez GeneALPK1 (a.k.a. 8430410J10Rik, LAK, ROSAH)
- Promoter doxycycline
-
Tag
/ Fusion Protein
- 3X flag (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CTGTCTGGTGGTTGAAGTCCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pInducer20 ALPK1 V1092A was a gift from Thomas Henry (Addgene plasmid # 231588 ; http://n2t.net/addgene:231588 ; RRID:Addgene_231588) -
For your References section:
IFN-gamma licenses normal and pathogenic ALPK1/TIFA pathway in human monocytes. Martin A, Caron S, Marcotte M, Bronnec P, Garneret E, Martel N, Maalouf G, Seve P, Saadoun D, Jamilloux Y, Henry T. iScience. 2024 Dec 10;28(1):111563. doi: 10.1016/j.isci.2024.111563. eCollection 2025 Jan 17. 10.1016/j.isci.2024.111563 PubMed 39868044