KHC065 pBABE pU6 BRD2 K1-2C
(Plasmid
#231712)
-
PurposeKHC065 (pBABE pU6 BRD2 K1-2C), gRNA and cas9D10A mammalian expression vector for CRISPR mediated cutting of BRD2 at the N-terminus, use with KHC064
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 231712 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBABE-pU6
- Backbone size w/o insert (bp) 5316
- Total vector size (bp) 5337
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA for Brd2 and Cas9D10A
-
gRNA/shRNA sequenceTCAGCCGCGGAAAGTCCGGG
-
SpeciesH. sapiens (human)
-
Entrez GeneBRD2 (a.k.a. BRD2-IT1, D6S113E, FSH, FSHRG1, FSRG1, NAT, O27.1.1, RING3, RNF3)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer pLKO.1 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
KHC065 pBABE pU6 BRD2 K1-2C was a gift from Alessio Ciulli (Addgene plasmid # 231712 ; http://n2t.net/addgene:231712 ; RRID:Addgene_231712) -
For your References section:
Development of BromoTag: A "Bump-and-Hole"-PROTAC System to Induce Potent, Rapid, and Selective Degradation of Tagged Target Proteins. Bond AG, Craigon C, Chan KH, Testa A, Karapetsas A, Fasimoye R, Macartney T, Blow JJ, Alessi DR, Ciulli A. J Med Chem. 2021 Oct 28;64(20):15477-15502. doi: 10.1021/acs.jmedchem.1c01532. Epub 2021 Oct 15. 10.1021/acs.jmedchem.1c01532 PubMed 34652918