Skip to main content

KHC065 pBABE pU6 BRD2 K1-2C
(Plasmid #231712)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 231712 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBABE-pU6
  • Backbone size w/o insert (bp) 5316
  • Total vector size (bp) 5337
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA for Brd2 and Cas9D10A
  • gRNA/shRNA sequence
    TCAGCCGCGGAAAGTCCGGG
  • Species
    H. sapiens (human)
  • Entrez Gene
    BRD2 (a.k.a. BRD2-IT1, D6S113E, FSH, FSHRG1, FSRG1, NAT, O27.1.1, RING3, RNF3)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    KHC065 pBABE pU6 BRD2 K1-2C was a gift from Alessio Ciulli (Addgene plasmid # 231712 ; http://n2t.net/addgene:231712 ; RRID:Addgene_231712)
  • For your References section:

    Development of BromoTag: A "Bump-and-Hole"-PROTAC System to Induce Potent, Rapid, and Selective Degradation of Tagged Target Proteins. Bond AG, Craigon C, Chan KH, Testa A, Karapetsas A, Fasimoye R, Macartney T, Blow JJ, Alessi DR, Ciulli A. J Med Chem. 2021 Oct 28;64(20):15477-15502. doi: 10.1021/acs.jmedchem.1c01532. Epub 2021 Oct 15. 10.1021/acs.jmedchem.1c01532 PubMed 34652918