Skip to main content

pCaggs-mGold2s
(Plasmid #231763)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 231763 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCaggs
  • Backbone size w/o insert (bp) 6105
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mGold2s
  • Alt name
    mGold(V1A;V22I;H77N;Q80R;K101E;D117G; I123V;S147C;Y151F;K156R;K158Q;A163V;D173V;G232S)
  • Alt name
    mVenus(V1A;V22I;L46F;T63S;H77N;Q80R;K101E;D117G; I123V;S147C;Y151F;K156R;K158Q;A163V;D173V;G232S)
  • Species
    Synthetic
  • Insert Size (bp)
    720
  • Mutation
    mGold2s is mGold with V1A;V22I;H77N;Q80R;K101E;D117G; I123V;S147C;Y151F;K156R;K158Q;A163V;D173V;G232S mutations
  • Promoter Actin promoter with CMV enhancer

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer aaggtggtggctggtgtggc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCaggs-mGold2s was a gift from Francois St-Pierre (Addgene plasmid # 231763 ; http://n2t.net/addgene:231763 ; RRID:Addgene_231763)
  • For your References section:

    Bright and photostable yellow fluorescent proteins for extended imaging. Lee J, Lai S, Yang S, Zhao S, Blanco FA, Lyons AC, Merino-Urteaga R, Ahrens JF, Nguyen NA, Liu H, Liu Z, Lambert GG, Shaner NC, Chen L, Tolias KF, Zhang J, Ha T, St-Pierre F. Nat Commun. 2025 Apr 4;16(1):3241. doi: 10.1038/s41467-025-58223-5. 10.1038/s41467-025-58223-5 PubMed 40185748