Skip to main content

pYY166 pcDNA3.4-His-MBP-hAID
(Plasmid #231942)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 231942 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.4
  • Backbone size w/o insert (bp) 7251
  • Total vector size (bp) 7848
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AID
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    597
  • GenBank ID
    NM_020661
  • Entrez Gene
    AICDA (a.k.a. AID, ARP2, CDA2, HEL-S-284, HIGM2)
  • Promoter CMV
  • Tag / Fusion Protein
    • His-MBP (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer AGCGTATCCACATAGCGT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Xie at al., EMBO J. 2022. https://doi.org/10.15252/embj.2021109324.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYY166 pcDNA3.4-His-MBP-hAID was a gift from Fei-Long Meng (Addgene plasmid # 231942 ; http://n2t.net/addgene:231942 ; RRID:Addgene_231942)
  • For your References section:

    Mesoscale DNA feature in antibody-coding sequence facilitates somatic hypermutation. Wang Y, Zhang S, Yang X, Hwang JK, Zhan C, Lian C, Wang C, Gui T, Wang B, Xie X, Dai P, Zhang L, Tian Y, Zhang H, Han C, Cai Y, Hao Q, Ye X, Liu X, Liu J, Cao Z, Huang S, Song J, Pan-Hammarstrom Q, Zhao Y, Alt FW, Zheng X, Da LT, Yeap LS, Meng FL. Cell. 2023 May 11;186(10):2193-2207.e19. doi: 10.1016/j.cell.2023.03.030. Epub 2023 Apr 24. 10.1016/j.cell.2023.03.030 PubMed 37098343