pYY166 pcDNA3.4-His-MBP-hAID
(Plasmid
#231942)
-
PurposeExpression of His-MBP-AID fusion protein in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 231942 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.4
- Backbone size w/o insert (bp) 7251
- Total vector size (bp) 7848
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAID
-
SpeciesH. sapiens (human)
-
Insert Size (bp)597
-
GenBank IDNM_020661
-
Entrez GeneAICDA (a.k.a. AID, ARP2, CDA2, HEL-S-284, HIGM2)
- Promoter CMV
-
Tag
/ Fusion Protein
- His-MBP (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer AGCGTATCCACATAGCGT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byXie at al., EMBO J. 2022. https://doi.org/10.15252/embj.2021109324.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYY166 pcDNA3.4-His-MBP-hAID was a gift from Fei-Long Meng (Addgene plasmid # 231942 ; http://n2t.net/addgene:231942 ; RRID:Addgene_231942) -
For your References section:
Mesoscale DNA feature in antibody-coding sequence facilitates somatic hypermutation. Wang Y, Zhang S, Yang X, Hwang JK, Zhan C, Lian C, Wang C, Gui T, Wang B, Xie X, Dai P, Zhang L, Tian Y, Zhang H, Han C, Cai Y, Hao Q, Ye X, Liu X, Liu J, Cao Z, Huang S, Song J, Pan-Hammarstrom Q, Zhao Y, Alt FW, Zheng X, Da LT, Yeap LS, Meng FL. Cell. 2023 May 11;186(10):2193-2207.e19. doi: 10.1016/j.cell.2023.03.030. Epub 2023 Apr 24. 10.1016/j.cell.2023.03.030 PubMed 37098343