TRE-pfv-Sapphire
(Plasmid
#231957)
-
PurposeThe plasmid containing TRE-pfv-Sapphire for the doxycycline-inducible expression of genetically encoded multimeric nanoparticles (GEM)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 231957 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLIX403
-
Vector typeMammalian Expression, Lentiviral ; Doxocycline inducible
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegenetically encoded multimeric nanoparticles
-
Alt nameGEM
-
SpeciesPyrococcus furiosus
-
Insert Size (bp)1816
-
GenBank IDAB214633.1
- Promoter tight TRE promoter
Cloning Information
- Cloning method Other
- 5′ sequencing primer gatcgcctggagaattggctagcatgctctcaataaatccaaccc
- 3′ sequencing primer gtggtggtggaccggttcatttgtacaattcatcaataccatg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.11.17.623896 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TRE-pfv-Sapphire was a gift from Michael Shtutman (Addgene plasmid # 231957 ; http://n2t.net/addgene:231957 ; RRID:Addgene_231957) -
For your References section:
Single Particle Tracking of Genetically Encoded Nanoparticles: Optimizing Expression for Cytoplasmic Diffusion Studies. Korunova E, Sikirzhystki V, Twiss JL, Vasquez P, Shtutman M. bioRxiv [Preprint]. 2024 Nov 18:2024.11.17.623896. doi: 10.1101/2024.11.17.623896. 10.1101/2024.11.17.623896 PubMed 39605363