pLenti-multi-CRISPR-sgMlkl_#1-puro
(Plasmid
#231979)
-
PurposeKnockout mouse Mlkl
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 231979 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti-multiCRISPR-Puro
-
Vector typeLentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA with Cas9 with puromycin resistance
-
gRNA/shRNA sequenceTTGGGACAGATCATCAAGTT
-
SpeciesM. musculus (mouse)
-
Entrez GeneMlkl (a.k.a. 9130019I15Rik)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer Unknown
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-multi-CRISPR-sgMlkl_#1-puro was a gift from Brian Ruffell (Addgene plasmid # 231979 ; http://n2t.net/addgene:231979 ; RRID:Addgene_231979) -
For your References section:
Interleukin-1alpha release during necrotic-like cell death generates myeloid-driven immunosuppression that restricts anti-tumor immunity. Hanggi K, Li J, Gangadharan A, Liu X, Celias DP, Osunmakinde O, Keske A, Davis J, Ahmad F, Giron A, Anadon CM, Gardner A, DeNardo DG, Shaw TI, Beg AA, Yu X, Ruffell B. Cancer Cell. 2024 Nov 13:S1535-6108(24)00402-1. doi: 10.1016/j.ccell.2024.10.014. 10.1016/j.ccell.2024.10.014 PubMed 39577420