Skip to main content
Addgene

pLenti-multi-CRISPR-sgMlkl_#2-puro
(Plasmid #231980)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 231980 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti-multiCRISPR-Puro
  • Vector type
    Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA with Cas9 with puromycin resistance
  • gRNA/shRNA sequence
    GCACACGGTTTCCTAGACGC
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Mlkl (a.k.a. 9130019I15Rik)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-multi-CRISPR-sgMlkl_#2-puro was a gift from Brian Ruffell (Addgene plasmid # 231980 ; http://n2t.net/addgene:231980 ; RRID:Addgene_231980)
  • For your References section:

    Interleukin-1alpha release during necrotic-like cell death generates myeloid-driven immunosuppression that restricts anti-tumor immunity. Hanggi K, Li J, Gangadharan A, Liu X, Celias DP, Osunmakinde O, Keske A, Davis J, Ahmad F, Giron A, Anadon CM, Gardner A, DeNardo DG, Shaw TI, Beg AA, Yu X, Ruffell B. Cancer Cell. 2024 Nov 13:S1535-6108(24)00402-1. doi: 10.1016/j.ccell.2024.10.014. 10.1016/j.ccell.2024.10.014 PubMed 39577420