MKT071
(Plasmid
#231995)
-
PurposeMicF RNA toehold switch with sfgfp reporter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 231995 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneColE1
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMicF RNA toehold switch
-
Insert Size (bp)98
- Promoter J23119
Cloning Information
- Cloning method Other
- 5′ sequencing primer tggcaattccgacgtctaagaaacca
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MKT071 was a gift from Melissa Takahashi (Addgene plasmid # 231995 ; http://n2t.net/addgene:231995 ; RRID:Addgene_231995) -
For your References section:
Improved RNA toehold switch sensitivity using the NanoLuc complementation reporter. Diaz KJ, Jarquin J, Petrosyan A, Takahashi MK. MicroPubl Biol. 2025 Jan 2;2025:10.17912/micropub.biology.001334. doi: 10.17912/micropub.biology.001334. eCollection 2025. 10.17912/micropub.biology.001334 PubMed 39839716