pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
(Plasmid
#231998)
-
PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR marker
-
Depositing Lab
-
Sequence Information
-
Please contact us if you would like Addgene to sequence a portion of this plasmid before you request it.
-
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 231998 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepX459 V2.0
- Backbone size w/o insert (bp) 9200
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCHMP2B-targeted sgRNA
-
gRNA/shRNA sequenceaattcccaaatgaagatggc
-
SpeciesH. sapiens (human)
-
Entrez GeneCHMP2B (a.k.a. ALS17, CHMP2.5, DMT1, FTDALS7, VPS2-2, VPS2B)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer Unknown (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.01.13.632710 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc was a gift from Franz-Ulrich Hartl (Addgene plasmid # 231998 ; http://n2t.net/addgene:231998 ; RRID:Addgene_231998)