pPgk-mTDGa-BioID2-HA
(Plasmid
#232030)
-
Purposemammalian expression (murine Pgk promoter) of murine TDG fused to BioID2-HA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232030 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneMCS-BioID2-HA
- Backbone size w/o insert (bp) 6112
- Total vector size (bp) 7086
-
Modifications to backbonereplacement of CMV by murine Pgk1 promoter
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameTdg
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1265
-
Entrez GeneTdg (a.k.a. E130317C12Rik, JZA-3, Jza1)
- Promoter Pgk1 promoter
-
Tag
/ Fusion Protein
- NLS (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer T7
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePgk1
-
SpeciesM. musculus (mouse); amplified from expression plasmid
-
Insert Size (bp)453
-
MutationPgk1 promoter variant
-
Entrez GenePgk1 (a.k.a. Pgk-1)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site MfeI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer AAAACAGGAAGGCAAAATGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPgk-mTDGa-BioID2-HA was a gift from Primo Schaer (Addgene plasmid # 232030 ; http://n2t.net/addgene:232030 ; RRID:Addgene_232030) -
For your References section:
The TDG protein environment connects active DNA demethylation with chromatin and RNA biology. Richina F, Noreen F, Bauer C, Weber A, Kunz C, Buczak K, Schwarz SD, Wu F, Schurmann D, Schar P. Cell Mol Life Sci. 2025 Nov 25. doi: 10.1007/s00018-025-05943-y. 10.1007/s00018-025-05943-y PubMed 41291101