Skip to main content

pPgk-NLS-BioID2-HA
(Plasmid #232031)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 232031 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    MCS-BioID2-HA
  • Backbone size w/o insert (bp) 6112
  • Total vector size (bp) 5850
  • Modifications to backbone
    replacement of CMV by murine Pgk1 promoter
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    NLS
  • Species
    Synthetic
  • Insert Size (bp)
    34
  • Tag / Fusion Protein
    • NLS (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer T7
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Pgk1 promoter
  • Species
    M. musculus (mouse); amplified from expression plasmid
  • Insert Size (bp)
    453
  • Mutation
    Pgk1 promoter variant
  • Entrez Gene
    Pgk1 (a.k.a. Pgk-1)
  • Promoter murine Pgk1

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site MfeI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer AAAACAGGAAGGCAAAATGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPgk-NLS-BioID2-HA was a gift from Primo Schaer (Addgene plasmid # 232031 ; http://n2t.net/addgene:232031 ; RRID:Addgene_232031)
  • For your References section:

    The TDG protein environment connects active DNA demethylation with chromatin and RNA biology. Richina F, Noreen F, Bauer C, Weber A, Kunz C, Buczak K, Schwarz SD, Wu F, Schurmann D, Schar P. Cell Mol Life Sci. 2025 Nov 25. doi: 10.1007/s00018-025-05943-y. 10.1007/s00018-025-05943-y PubMed 41291101