pET28-NFMshuf1
(Plasmid
#232058)
-
PurposeExpresses construct for surface tethering: R. norvegicus NFM tail domain with more evenly distributed charged residues, sequence 1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232058 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET28a
- Backbone size w/o insert (bp) 5200
- Total vector size (bp) 6600
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNeurofilament-Medium tail domain, charge shuffle 1
-
SpeciesR. norvegicus (rat), Synthetic
-
Insert Size (bp)1400
-
Tag
/ Fusion Protein
- 6xHis, thrombin (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28-NFMshuf1 was a gift from Sanjay Kumar (Addgene plasmid # 232058 ; http://n2t.net/addgene:232058 ; RRID:Addgene_232058) -
For your References section:
Dissecting neurofilament tail sequence-phosphorylation-structure relationships with multicomponent reconstituted protein brushes. Ding EA, Yokokura TJ, Wang R, Kumar S. Proc Natl Acad Sci U S A. 2024 Dec 3;121(49):e2410109121. doi: 10.1073/pnas.2410109121. Epub 2024 Nov 27. 10.1073/pnas.2410109121 PubMed 39602260