Skip to main content

pET28-NFMshuf1
(Plasmid #232058)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 232058 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET28a
  • Backbone size w/o insert (bp) 5200
  • Total vector size (bp) 6600
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Neurofilament-Medium tail domain, charge shuffle 1
  • Species
    R. norvegicus (rat), Synthetic
  • Insert Size (bp)
    1400
  • Tag / Fusion Protein
    • 6xHis, thrombin (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28-NFMshuf1 was a gift from Sanjay Kumar (Addgene plasmid # 232058 ; http://n2t.net/addgene:232058 ; RRID:Addgene_232058)
  • For your References section:

    Dissecting neurofilament tail sequence-phosphorylation-structure relationships with multicomponent reconstituted protein brushes. Ding EA, Yokokura TJ, Wang R, Kumar S. Proc Natl Acad Sci U S A. 2024 Dec 3;121(49):e2410109121. doi: 10.1073/pnas.2410109121. Epub 2024 Nov 27. 10.1073/pnas.2410109121 PubMed 39602260