Skip to main content

pCRISPEY-GAL-Kan-ADE2
(Plasmid #232105)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 232105 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCRISPEY-GAL-Kan
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    Kanamycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ADE2 gRNA and repair template
  • gRNA/shRNA sequence
    ACTTTGGCATACGATGGAAG
  • Species
    S. cerevisiae (budding yeast)
  • Mutation
    Repair template introduces C at nt 466 of ADE2 to create frameshift mutation
  • Promoter GAL7

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Gibson cloning at NotI sites . Please visit https://doi.org/10.1101/2024.08.06.606807 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRISPEY-GAL-Kan-ADE2 was a gift from Jeffrey Lewis (Addgene plasmid # 232105 ; http://n2t.net/addgene:232105 ; RRID:Addgene_232105)
  • For your References section:

    Improved vectors for retron-mediated CRISPR-Cas9 genome editing in Saccharomyces cerevisiae. Stuecker TN, Hood SE, Molina Pineda J, Lenaduwe S, Winter J, Sadhu MJ, Lewis JA. G3 (Bethesda). 2025 Aug 4:jkaf175. doi: 10.1093/g3journal/jkaf175. 10.1093/g3journal/jkaf175 PubMed 40758833