pCRISPEY-Z3-Nat-ADE2
(Plasmid
#232106)
-
PurposeExpresses estradiol-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232106 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCRISPEY-Z3-Nat
-
Vector typeYeast Expression, CRISPR
-
Selectable markersNourseothricin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameADE2 gRNA and repair template
-
gRNA/shRNA sequenceACTTTGGCATACGATGGAAG
-
SpeciesS. cerevisiae (budding yeast)
-
MutationRepair template introduces C at nt 466 of ADE2 to create frameshift mutation
- Promoter Z3
Cloning Information
- Cloning method Gibson Cloning
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Gibson cloning at XhoI sites . Please visit https://doi.org/10.1101/2024.08.06.606807 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPEY-Z3-Nat-ADE2 was a gift from Jeffrey Lewis (Addgene plasmid # 232106 ; http://n2t.net/addgene:232106 ; RRID:Addgene_232106) -
For your References section:
Improved vectors for retron-mediated CRISPR-Cas9 genome editing in Saccharomyces cerevisiae. Stuecker TN, Hood SE, Molina Pineda J, Lenaduwe S, Winter J, Sadhu MJ, Lewis JA. G3 (Bethesda). 2025 Aug 4:jkaf175. doi: 10.1093/g3journal/jkaf175. 10.1093/g3journal/jkaf175 PubMed 40758833