pNEU-KlacRS
(Plasmid
#232155)
-
PurposeSite-specific incorporation of L-lactyl-lysine into target proteins in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232155 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepNEU-hMbPylRS-4xU6M15
-
Vector typeMammalian Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKlacRS1
-
SpeciesSynthetic
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that this plasmid only has 3xU6M15, rather than 4x. The depositor has confirmed that this does not affect the functionality of the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNEU-KlacRS was a gift from Nanxi Wang (Addgene plasmid # 232155 ; http://n2t.net/addgene:232155 ; RRID:Addgene_232155) -
For your References section:
Genetic code expansion reveals site-specific lactylation in living cells reshapes protein functions. Shao C, Tang S, Yu S, Liu C, Zhang Y, Wan T, He Z, Yuan Q, Wu S, Zhang H, Wan N, Zhan M, Tan RX, Hao H, Ye H, Wang N. Nat Commun. 2025 Jan 8;16(1):227. doi: 10.1038/s41467-024-55165-2. 10.1038/s41467-024-55165-2 PubMed 39779673