pEvol-chKlacRS-WT
(Plasmid
#232159)
-
PurposeA chimeric PylRS for site-specific incorporation of L-lactyl-lysine into target proteins in E.coli cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232159 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEvol
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namechKlacRS-WT
-
SpeciesSynthetic
-
Insert Size (bp)1260
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer atgccatagcatttttatcc
- 3′ sequencing primer cctgatacagattaaatc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEvol-chKlacRS-WT was a gift from Nanxi Wang (Addgene plasmid # 232159 ; http://n2t.net/addgene:232159 ; RRID:Addgene_232159) -
For your References section:
Genetic code expansion reveals site-specific lactylation in living cells reshapes protein functions. Shao C, Tang S, Yu S, Liu C, Zhang Y, Wan T, He Z, Yuan Q, Wu S, Zhang H, Wan N, Zhan M, Tan RX, Hao H, Ye H, Wang N. Nat Commun. 2025 Jan 8;16(1):227. doi: 10.1038/s41467-024-55165-2. 10.1038/s41467-024-55165-2 PubMed 39779673