pSJX024
(Plasmid
#232327)
-
PurposeGenome editing in Caulobacter crescentus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232327 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBXMCS2
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namesgRNA
-
Alt namespmX
-
Alt nameLysozyme-family localization factor spmX
-
SpeciesCaulobacter crescentus
- Promoter PJ23119
-
Tag
/ Fusion Protein
- H-arms (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer Unknown
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameSpCas9M
- Promoter Pxyl
-
Tag
/ Fusion Protein
- cat (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer Unknown
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
sgRNA sequence: tctcttgatgagatcgacgg
Please visit https://doi.org/10.1101/2024.12.02.626314 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSJX024 was a gift from Wei Zhao (Addgene plasmid # 232327 ; http://n2t.net/addgene:232327 ; RRID:Addgene_232327) -
For your References section:
A CRISPR-SpCas9M-reporting system for efficient and rapid genome editing in Caulobacter crescentus. Sun J, Yu X, Tang G, Chen M, Zheng Y, Hu Y, Li Q, Li X, Li N, Li Z, Li Y, Lu N, Tan W, Yang Y, Lyu X, Zhao G, Wang H, Dai L, Zhao GP, Ai L, Zhao W. Nucleic Acids Res. 2025 Apr 22;53(8):gkaf353. doi: 10.1093/nar/gkaf353. 10.1093/nar/gkaf353 PubMed 40298107