Skip to main content
Addgene

pcDNA3.1-eIF4E
(Plasmid #232336)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 232336 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1 (-)
  • Backbone manufacturer
    Invitrogen (Thermo Fisher)
  • Backbone size w/o insert (bp) 5427
  • Total vector size (bp) 6011
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eIF4E
  • Alt name
    ENST00000450253.7
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_001968.5
  • Entrez Gene
    EIF4E (a.k.a. AUTS19, CBP, EIF4E1, EIF4EL1, EIF4F, eIF-4E)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CMV-F: CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer BGH-R: TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Yuxin Bi (毕雨馨 in simplified Chinese), the first author of the article, construct this plasmid during her master's degree. She graduated and become a PHD candidate in other institute for now.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-eIF4E was a gift from Quanfu Ma (Addgene plasmid # 232336 ; http://n2t.net/addgene:232336 ; RRID:Addgene_232336)