pcDNA3.1-eIF4E
(Plasmid
#232336)
-
PurposeExpresses human eIF4E (ENST00000450253.7, NM_001968.5) in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232336 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1 (-)
-
Backbone manufacturerInvitrogen (Thermo Fisher)
- Backbone size w/o insert (bp) 5427
- Total vector size (bp) 6011
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeIF4E
-
Alt nameENST00000450253.7
-
SpeciesH. sapiens (human)
-
GenBank IDNM_001968.5
-
Entrez GeneEIF4E (a.k.a. AUTS19, CBP, EIF4E1, EIF4EL1, EIF4F, eIF-4E)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CMV-F: CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer BGH-R: TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byYuxin Bi (毕雨馨 in simplified Chinese), the first author of the article, construct this plasmid during her master's degree. She graduated and become a PHD candidate in other institute for now.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-eIF4E was a gift from Quanfu Ma (Addgene plasmid # 232336 ; http://n2t.net/addgene:232336 ; RRID:Addgene_232336)