pcDNA3.1-IARS2
(Plasmid #232337)

• Purpose: Expresses human IARS2 (ENST00000366922.3, NM_018060.4) in mammalian cells
• Depositing Lab: Quanfu Ma
• Publication: Mechanism of Isoleucyl-tRNA synthetase 2 regulating proliferation and apoptosis of cervical cancer cells (unpublished)

Backbone

• Vector backbone: pcDNA3.1 (-)
• Backbone manufacturer: Invitrogen (Thermo Fisher)
• Backbone size w/o insert (bp): 5427
• Total vector size (bp): 8445
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: IARS2
• Alt name: ENST00000366922.3
• Species: H. sapiens (human)
• GenBank ID: NM_018060.4
• Entrez Gene: IARS2 (a.k.a. CAGSSS, ILERS)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (destroyed during cloning)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CMV-F: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: BGH-R: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • pcDNA3.1-IARS2.gb
• A portion of this plasmid was derived from a plasmid made by: Yuxin Bi (毕雨馨 in simplified Chinese), the first author of the article, constructed this plasmid during her master's degree. She graduated and become a PHD candidate in other institute for now.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note1:
At the 5' of the IARS2 insert, we use diffrernt restriction enzyme for the insert and the backbone. Xho I for pcDNA3.1 (-) and Sal I for IARS2 ORF. The Xho I and Sal I share a compatible cohesive end. Ligation between the compatible cohesive ends generated by different enzymes destroy the 5' restriction site. We use this cloning method because that IARS2 ORF (ENST00000366922.3) bears intrinsic Xho I site.

Note2:
The IARS2 ORF is long, so we used additional primers (5'->3') for sanger sequencing as follows:
pc3.1-IARS2-P1: tgggaagtatgaagccaaacagt
pc3.1-IARS2-P2: gaccatggcaaaaggaacgg
pc3.1-IARS2-P3: caacagccaaaccactgagc
pc3.1-IARS2-P4: tgctcaatgctgccagaga

Note3:
The putative Kozak sequence (ENST00000366922.3:c.-6~-1) was also included

Note4:
There is a discrepancy in the backbone in the SV40 promoter where the Addgene NGS sequence contains an indel compared to the depositor reference. However, this indel does not affect the function of the plasmid because the SV40 promoted G418 resistant gene was not used in the study. The depositor used these plasmids for transient overexpression, not stable expression.