Skip to main content

pcDNA3.1-IARS2-H112A/P115A
(Plasmid #232338)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 232338 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1 (-)
  • Backbone manufacturer
    Invitrogen (Thermo Fisher)
  • Backbone size w/o insert (bp) 5427
  • Total vector size (bp) 8445
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IARS2
  • Alt name
    ENST00000366922.3
  • Species
    H. sapiens (human)
  • Mutation
    Putative isoleucine binding deficiency mutation H112A AND P115A. Also carrying all 5 siRNA off-targeting synonymous mutations described in Addgene plasmid #232340.
  • GenBank ID
    NM_018060.4
  • Entrez Gene
    IARS2 (a.k.a. CAGSSS, ILERS)
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CMV-F: CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer BGH-R: TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Yuxin Bi (毕雨馨 in simplfied Chinese), the first author of the article, constructed this plasmid during her master's degree. She graduated and become a PHD candidate in other institute for now.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note1:
For seamless cloning, the pcDNA3.1 (-) vector was single digested with Pme I and the two fragment were generated By PCR with Addgene #232340 as template and the following primers (5'->3'):
fragment 1:
3.1Pme-F: GGAGACCCAAGCTGGCTAGCGTTT
IARS2-H112A+P115A-R: ttgcataaggagctccatcagcaaggcaaaattctg
fragment 2:
IARS2-H112A+P115A-F: cagaattttgccttgctgatggagctccttatgcaa
3.1Pme-R: ACAGTCGAGGCTGATCAGCGGTTT

Note2:
The IARS2 ORF is long, so we used additional primers (5'->3') for sanger sequencing as follow:
pc3.1-IARS2-P1: tgggaagtatgaagccaaacagt
pc3.1-IARS2-P2: gaccatggcaaaaggaacgg
pc3.1-IARS2-P3: caacagccaaaccactgagc
pc3.1-IARS2-P4: tgctcaatgctgccagaga

Note3:
The putative Kozak sequence (ENST00000366922.3:c.-6~-1) was also included

Note4:
Also carrying all 5 siRNA off-targeting synonymous mutations described in Addgene plasmid #232340.

Note5:
There is a discrepancy in the backbone in the SV40 promoter where the Addgene NGS sequence contains an indel compared to the depositor reference. However, this indel does not affect the function of the plasmid because the SV40 promoted G418 resistant gene was not used in the study. The depositor used these plasmids for transient overexpression, not stable expression.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-IARS2-H112A/P115A was a gift from Quanfu Ma (Addgene plasmid # 232338 ; http://n2t.net/addgene:232338 ; RRID:Addgene_232338)