pcDNA3.1-IARS2-tb
(Plasmid
#232340)
-
PurposeExpresses human IARS2 with synonymous mutations (to prevent recognition by siRNA) in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232340 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1 (-)
-
Backbone manufacturerInvitrogen (Thermo Fisher)
- Backbone size w/o insert (bp) 5427
- Total vector size (bp) 8445
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIARS2
-
Alt nameENST00000366922.3
-
SpeciesH. sapiens (human)
-
Mutation5 synonymous mutations in the siRNA (ACUUGCAGUCAUCCAUUAA) targeting region, in order to let the plasmid to be siRNA off-targeted.
-
GenBank IDNM_018060.4
-
Entrez GeneIARS2 (a.k.a. CAGSSS, ILERS)
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CMV-F: CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer BGH-R: TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byYuxin Bi (毕雨馨 in simplified Chinese), the first author of the article, constructed this plasmid during her master's degree. She graduated and become a PHD candidate in other institute for now.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note1:
For seamless cloning, the pcDNA3.1 (-) was single digested with Pme I and the two fragment were generated By PCR with Addgene #232337 as template and the following primers (5'->3'):
fragment 1:
3.1Pme-F: GGAGACCCAAGCTGGCTAGCGTTT
IARS2-9tb-R: tttatcaggaatcagagggtggctgcaagtacca
fragment 2:
IARS2-9tb-F: tggtacttgcagccaccctctgattcctgataaa
3.1Pme-R: ACAGTCGAGGCTGATCAGCGGTTT
Note2:
The IARS2 ORF is long, so we used additional primers (5'->3') for sanger sequencing as follow:
pc3.1-IARS2-P1: tgggaagtatgaagccaaacagt
pc3.1-IARS2-P2: gaccatggcaaaaggaacgg
pc3.1-IARS2-P3: caacagccaaaccactgagc
pc3.1-IARS2-P4: tgctcaatgctgccagaga
Note3:
The putative Kozak sequence (ENST00000366922.3:c.-6~-1) was also included
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-IARS2-tb was a gift from Quanfu Ma (Addgene plasmid # 232340 ; http://n2t.net/addgene:232340 ; RRID:Addgene_232340)