pcDNA3.1-flag-IARS2-Δ1-48
(Plasmid
#232341)
-
PurposeExpresses human IARS2 with mito-location signal replaced by flag tag in mammalian cells, also carrying synonymous mutations described in Addgene #232340
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232341 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1-Flag (Addgene #208051)
- Backbone size w/o insert (bp) 5476
- Total vector size (bp) 8350
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIARS2
-
Alt nameENST00000366922.3
-
SpeciesH. sapiens (human)
-
MutationResidues 1-48 (indicated as Mito-signal in UniProt Q9NSE4) were deleted. Also carrying all 5 siRNA off-targeting synonymous mutations described in Addgene plasmid #232340.
-
GenBank IDNM_018060.4
-
Entrez GeneIARS2 (a.k.a. CAGSSS, ILERS)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CMV-F: CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer BGH-R: TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byYuxin Bi (毕雨馨 in simplified Chinese), the first author of the article, constructed this plasmid during her master's degree. She graduated and become a PHD candidate in other institute for now.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note1:
At the 5' of the IARS2 insert, we use different restriction enzymes for the insert and the backbone. Xho I for pcDNA3.1 (-) and Sal I for IARS2 ORF. The Xho I and Sal I share a compatible cohesive end. Ligation between the compatible cohesive ends generated by different enzymes destroy the 5' restriction site. We use this cloning method because that IARS2 ORF (ENST00000366922.3) bears intrinsic Xho I site.
Note2:
The IARS2 ORF is long, so we used additional primers (5'->3') for sanger sequencing as follow:
pc3.1-IARS2-P1: tgggaagtatgaagccaaacagt
pc3.1-IARS2-P2: gaccatggcaaaaggaacgg
pc3.1-IARS2-P3: caacagccaaaccactgagc
pc3.1-IARS2-P4: tgctcaatgctgccagaga
Note3:
The Flag tag in this plasmid was not tested in wenstern blot in the article because the IARS2 antibody is good enough.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-flag-IARS2-Δ1-48 was a gift from Quanfu Ma (Addgene plasmid # 232341 ; http://n2t.net/addgene:232341 ; RRID:Addgene_232341)