Skip to main content
Addgene

pcDNA3.1-flag-IARS2-Δ1-48
(Plasmid #232341)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 232341 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1-Flag (Addgene #208051)
  • Backbone size w/o insert (bp) 5476
  • Total vector size (bp) 8350
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IARS2
  • Alt name
    ENST00000366922.3
  • Species
    H. sapiens (human)
  • Mutation
    Residues 1-48 (indicated as Mito-signal in UniProt Q9NSE4) were deleted. Also carrying all 5 siRNA off-targeting synonymous mutations described in Addgene plasmid #232340.
  • GenBank ID
    NM_018060.4
  • Entrez Gene
    IARS2 (a.k.a. CAGSSS, ILERS)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CMV-F: CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer BGH-R: TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Yuxin Bi (毕雨馨 in simplified Chinese), the first author of the article, constructed this plasmid during her master's degree. She graduated and become a PHD candidate in other institute for now.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note1:
At the 5' of the IARS2 insert, we use different restriction enzymes for the insert and the backbone. Xho I for pcDNA3.1 (-) and Sal I for IARS2 ORF. The Xho I and Sal I share a compatible cohesive end. Ligation between the compatible cohesive ends generated by different enzymes destroy the 5' restriction site. We use this cloning method because that IARS2 ORF (ENST00000366922.3) bears intrinsic Xho I site.

Note2:
The IARS2 ORF is long, so we used additional primers (5'->3') for sanger sequencing as follow:
pc3.1-IARS2-P1: tgggaagtatgaagccaaacagt
pc3.1-IARS2-P2: gaccatggcaaaaggaacgg
pc3.1-IARS2-P3: caacagccaaaccactgagc
pc3.1-IARS2-P4: tgctcaatgctgccagaga

Note3:
The Flag tag in this plasmid was not tested in wenstern blot in the article because the IARS2 antibody is good enough.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-flag-IARS2-Δ1-48 was a gift from Quanfu Ma (Addgene plasmid # 232341 ; http://n2t.net/addgene:232341 ; RRID:Addgene_232341)