pcDNA5 FRT to BioID-nDIC2-3xFlag
(Plasmid
#232418)
-
PurposeExpresses human dynein subunit DIC2 in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232418 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA5
- Backbone size w/o insert (bp) 5738
- Total vector size (bp) 7574
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDynein Intermediate Chain 2
-
Alt nameDIC2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1884
-
GenBank IDAK091339.1
-
Entrez GeneDYNC1I2 (a.k.a. DIC74, DNCI2, IC2, NEDMIBA)
- Promoter CMV
-
Tags
/ Fusion Proteins
- BioID (N terminal on insert)
- Flag-3x (N terminal on insert)
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA5 FRT to BioID-nDIC2-3xFlag was a gift from Samara Reck-Peterson (Addgene plasmid # 232418 ; http://n2t.net/addgene:232418 ; RRID:Addgene_232418) -
For your References section:
The human cytoplasmic dynein interactome reveals novel activators of motility. Redwine WB, DeSantis ME, Hollyer I, Htet ZM, Tran PT, Swanson SK, Florens L, Washburn MP, Reck-Peterson SL. Elife. 2017 Jul 18;6:e28257. doi: 10.7554/eLife.28257. 10.7554/eLife.28257 PubMed 28718761